1. A very brief introduction to Bioinformatics:

There are some very basic guidelines that you will need to understand before you attempt your assignment. These are listed below

2. The Assignment:

The following sequences are given to you for analysis. Note that the sequences are in FASTA format (you should have noted this file format by now).
(a) Choose any one sequence and copy it.
(b) Click the Bioinformatics help pages.
(c) Paste your selected sequence following the instructions provided on the page.
>clone 3:20 
TGCTTGCCGACGTACCAGCCCAGAGAATAGGTGCAGCCACGAAAGCAAGACAAATAGCTTTCA
AAGAGATTATGGAACGAACGATGATGAATAAAAACAGGTGGTGCGTCGCTGGCGTACCAAAT
CCTGAATGGGCACGAAAAGTTTACGGCACAGAAGACATTACACAACTTTGGAACGATATCCTA
TATATGGCAAGAATAGATGAAAATGGATATGATGCGTTACTCAAGCATCTGGAAAATCTTAAA
AATAGAAAGGGACTACCTTAATGAGATGAAATTTGAGGCATTGAGATACGAA

>clone 8:7 
TGCTTGCCGACGTACCAGCCCAGAGAATAGGTGCAGCCACGAAAGCAAGACAAATAGCTTTCA
AAGAGATTATGGAACGAACGATGATGAATAAAAACAGGTGGTGCGTCGCTGGCGTACCAAAT
CCTGAATGGGCACGAAAAGTTTACGGCACAGAAGACATTACACAACTTTGGAACGATATCCTA
TATATGGCAAGAATAGATGAAAATGGATATGATGCGTTACTCAAGCATCTGGAAAATCTTAAA
AATAGAAAGGACTACCTTAATGAGATGAAATTTGAGGCATTGAGATACGAAGGACCTGGTTAC
AGAATTAGTTGTTGAATTGCCACCGCTCCTCTTTGGCTAAGC

>clone 11:8 
AATTTCGGACCTTCGGGTGTAATTTCCGTAGTTGCGTTCCACACTTTCTTATCAAAACCTTTCC
ATCCTCCATGCAAGGCATTGGACCTTTTACCACCGCCATCATTAAGCGCGAGTTGATATTGCAC
GCTATCGATAACAAACCTGCCATTCGCTATTCTGTTTGCGTATCTCCCAATAATTGTGCCCAAG
TAACCGGGATTTTTCTCGTATTC

>clone 12:43 
TTATCTTCGATTTCCAGCAGCTCGACAGACTTTTTCCAAATGTCTTCTTTCGGACTTGCGATGTT
CACAAGATAACCGGCATGGCAAAGGAAATATTCTGGGTTGAGATTGTACTTCTTCACATCTCT
CAGAAAATGGATAATATCATCATCTGACGGTAGTTTTGCCTGCCACTGTCTCGGGTTGTGCGG
AAATATTTGAAACGCGTTCCCGCCGTATTTCAACCCGTCTCTTTT

>clone 24:27 
CACACAGGGAGCAGAGGATTTGGACATCAAATAGCAACGGACTACATAAAGCTGATGAGGGA
CAACTTAAAAGAACACAACAAAAATCTCCCTGATAAGCAATTAATAAACGCACCATTTAAAAG
TGATTGGGGACAGAAATACTACAGTGCGATGAATTGTGCAGCGAATTACGCTTTTGCAAATAG
GCAGATAATAACACATCTTATCAGGAAGGT

>clone 26:31 
TTCATGGATCTCAAGTTCTTTCGCAATGCCCATCGAATGGAGAACCCTTCCACCTGAAACTAAA
AGTTTCCCTTCTTTTTCTTTAACACCTGCATAGAAGAAGAAACCACCGTCAATGTCTATAGTCT
GTCCTTTTTCCGGATTTTCTGGATAACCTCGCGAGGCTATCACCAATATCAACAGCAAAGTTTT
CAGGCTTATATTCTCCAAACGGTTCGTT

>clone 34:05 
AAGTCCTTGCTTTATGTAATACAAAAAACCACCTGGAACTAATCCACCATTTTCTAAAACCTGA
GGTTCAGCCAGAACACCAGTCGCAAGTAAAGGAATATTCGAGAAAATTATACCGAAAGCAAT
AGGAATTAAGAGAAGAGGTTCAGCATCTTTTTTCACAGCAACATACACCAGAACACCAGCGAT
AATTAACATGAAAATATTACCCATAGTAAGCTGTGCAAAGCCCGTACTTTGGAAAAACAAAGC
GAACTGATCCAGCATTTNCTTAGCCCTCCCACTATTAATATTTTTTGTTTTTATCTCA

>clone 34:05 
TCGACTTTGCACTTGAAAAATTTGAAAAGGTTGGGAAGAAATTGGCGGTGATATGATAAAATC
AAACCGGGTGGTTCTCACCCGGTTTAATTTTGCACATTAGAGGTGAGGATTATGAAGCTCATC
ACTTATCCTCCGAACAGTGTTATATATAAAGAAGGTGAGGTTCCGCAATCGATTTACTACATA
GTTAACGGCTCTATTAGCGTAAAGCTCTTTAGAAAAGAAAAACAGATAGAAAGCGGTACAATC
GGTGAAGTGGGGTATTTATAATATCCCTTCAGAA

>clone 34:22 
CACAGCAAGCGAAAATATTTGTTGAGGAAACAGGAGTAGACTTTCTTGCGCCAGCTATCGGGA
CAAGCCATGGTGCGTTCAAGTTCAAGGGAGATGCAAAACTCGATTTCGAAAGGTTAAAGACTG
TTAAGGAACTAACAAAAAGGCCGCTCGTATTGCATGGTGCATCAAGCGTTTTGCCGGAATATG
TGAAGTTGGCAGAANAATACGGTGCGGATTTGGGCGGTGCAAAAGGTGTTCCTGAAGGAAGA
ATTTGAA

>clone 34:22 
AAATCCTTTGCATCGTTATATGTTGCCATGATGTCTCTTATCAACCTTGCAGCCTGAATGTGCT
CAGGTTTAGTTACGTCCACCATCAACCTACTTATACTCATCAAGACATCAACTGCTGGGTAATG
ATTTGATTCAGCTAACCTTCTTGAAAGTATTATGTGCCCATCAACGATACCACGCACAGTATCT
GAAATTGGTCGTTAAAATCCGTCCCGCTTCTACAAAAACGGTATATTATGCCCGTTTATACTAA
CCTTTGTCA

>clone 37:1 
TCAGAATTCTTTTTGAAAGCAGAGACGATGTTTACAGCAAGTTCAGGCGCGGAAGTACCAAAC
GATACGATAGTTAGGCCAATCACCAAATCAGAAACTCTCAATCGCTTCGCGATATTCGAAGCC
CCTTCAACGAGTTTATCCGCACCAAAGCTAACAAGGAAGAATCCAACTAAAAGCAACAAAAAA
CTGAAGAACAAGTTCATTCACCTCTCGATGATTTGTATTTTTATAGTACGTTCTGGTATATATT
ATAAGACAGTTGTTCGATTTTTGCCATTCTCTTTCGAAATGTACAATGCTTCATCGCATCTTTTC
AAGAAACTTTCAATACTGTCTTCACCTTTCAATT

>clone 37:19 
TGCATTCTGACAAATCTTGAAACTTGGATATTCTCTCCAATCTTTGCGATTGCTTGCTGAATCA
TGTCCTTAATTGTTATTGTCTGGTCAAGGGCATATTTTTGTTCGAGCAGACAGTAGTCCTGATA
GAAGCTTTCGAGTTTTCCTTCGATTATCTTTTCAATGACTTGTGTTGGCTTTCCGGAATCTTTAA
GCTGGTCTCTGTATATTTTCTTTTTCCTTTTCAATAACATCAGCTGGTACATCTTCTCTCTTAAC
CCATCTTGGGAGCCATCGCTGCAATGTGCATAGCTATCTTTGTTCCCAAGTNCTTTGAATTCAT
CTGTTC

>clone 37:19 
AGTGAGACACCAACCAGTATCAGTGGTAACAAAAGTAACCTCCTGATGATAAACGTGGTCAAC
TAAACCCACCTCCTATAAGAATTTTAAAAAATTGAGATTGTAGGGTGTTTTACTTTTACTTCAT
AAATTATAACACCAATGCCGTGATTATCAACTTACTTAACCATTAGTTTAAACATCTCTGAGAC
CAGATAGTTCACTTAGCAAACTTTTCTGCAGCCTTTTTTTCCTATTAATTGCTCGATTTCTGCCC
TTGACGCATTTCTCAATTCATCAACCGAAGTGTAACGTTCAAGTAATAAGCGTGTGCGTTTTGG
ACCTATCAATTTATATAGTCATCTAAGAACGCTTCTTAGACGATGTTCTTAGATGATGACTGCG
CGAGTAAGACTTATTGGCTACGCGGTGCGTTTCGTCCCGTAACTTTACTAAAAGTCTTAGTACT
GGATGATTGTAGTCTAACCTTACCATGCCATGTTTTGTAACTATTATCTCTTCCTCTTTTGCTAA
ACCTATAACATCACAGTCCTTGTTGATTTCTTGTGCAAAGCATTATATGCAGAATTTACTTGCC
CAATTCCACCATCGACAAACAGTAAATCCGGCAACTCATGTTTAACATATCGTCGTTTTACGAC
CATCTCTATGCTTTTGAAGTCATCAAGCACATCGCCTAATTTGTATCTCCTATATTCATCTT

>clone 38:20 
GCATGATAAAGGTTGATATGCGCGAACATGTTATCGATGTACCACCTCAAGAGGTCATTACAA
AAGATAACGTGGTTGTAGTGGTCGATGCTGTTATCTATTACGAAGTAACAGATGCATTCAAAT
CAGTGTACAATGTCAACAACTTTGAATTTGCAACTATAAAACTTGCGCAAACAAACTTGAGAA
ATGTCATAGGTGAACTGGAGCTTGACCAGACCCTTACGTCGAGAGAGAGTATTAATGCAAAGT
TAAGAACAGTATTAGACGAAGCGACTGATAAATGGGGAATTAGGATTACG