Short Answer Questions

  1. What is the evidence that prokaryotic life forms were present on Earth billions of years before Eucaryotic life forms?

  2. What major features would primitive organisms have had to have in order to replicate copies of themselves. Why?

  3. What major features would primitive organisms have had to have in order to replicate copies of themselves. Why?

  4. What properties of RNA could have made possible an era of RNA life? If RNA life forms ever existed, why is there no trace of them today?

  5. What might have been the advantage of abandoning the era of RNA life for cellular life based on DNA, RNA and protein?

  6. Why are macromolecules like nucleic acids or proteins excellent phylogenetic markers whereas polysaccharides and lipids are not?

  7. Why are ribosomal RNAs better molecules for phylogenetic studies tha proteins like ferrodoxin, cytochromes or specific proteins?

  8. What are signature sequences and of what value are they? How are signature sequences discerned?

  9. What is FISH technology? Give an example of how it would be used?

  10. Describe the methods involved in obtaining 16S rRNA sequences.How has the polymerase chain reaction benefited molecular phylogeny?

  11. What major evolutionary finding has emerged from the study of ribosomal RNA sequences? How did this modify the classic view of evolution? How has this discovery changed our thinking of eucaryotic organisms?

  12. What major lesson has microbiology learned from RNA sequencing concerning the use of phenotypic criteria in establishing evolutionary relationships?

  13. What major physiological and biochemical properties do Archaea share with Eucarya? With Bacteria?

  14. What major phenotypic properties are used to group organisms in classical bacterial taxnonomy? Which, if any, of these properties have phylogenetic predictive values?

  15. Why aren't GC base ratios useful for making phylogenetic determinations? In what situation are GC base ratios of use in taxonomic studies?

  16. How does ribotyping differ from 16S sequencing as an identification tool?

  17. What is measure in FAME analysis?

  18. Why is it highly unlikey that life could originate today as it did billions of years ago?

  19. Imagine that you are debating someone who is arguing against the theory of endosymbiosis. List five forms of evidence you would use to convince your opponent that endosymbiosis did occur.

  20. On the basis of the following sequences, calculate an evolutionary distance between these three organisms and predict which two of the three are most closely related.
    Organism 1: AGGUACGUUA
    Organism 2: UGCCACGGUU
    Organism 3: AGGUACGGUA

  21. Determine the GC ratio of the following stretch of DNA.
    TAAGCCTGCAAGCTTAGCTAATTCGGACGTTCGAATCGAT

Send comments, errors and suggestions to Associate Professor Bharat Patel: B.Patel@griffith.edu.au
Created: 9 Oct 2002
Modified: 9 Oct 2002